Cracking the genetic code: replicating a scientific discovery Teach article

Get your students to crack the genetic code for themselves.

In 1958, Crick postulated the central dogma of molecular biology: that the flow of information goes from DNA to RNA to protein. But the question remained: how did the four-letter alphabet of nucleotides in DNA (A, C, T and G) or its equivalent in RNA (A, C, U and G) encode the 20-letter alphabet of amino acids that build our proteins? What was the genetic code?

In 1961, Marshall W Nirenberg and Johann H Matthaei deciphered the first letter of the code, revealing that the RNA sequence UUU encodes the amino acid phenylalanine. Subsequently, Har Gobind Khorana showed that the repeating nucleotide sequence UCUCUCUCUCUC encodes a strand of amino acids reading serine-leucine-serine-leucine. By 1965, largely due to the work of Nirenberg and Khorana, the genetic code had been completely cracked. It revealed that each group of three nucleotides (known as codons) encodes a specific amino acid, and that the order of the codons determines the order of amino acids in (and, consequently, the chemical and biological properties of) the resulting protein.

The genetic code itself is a crucial element of biology lessons, providing a molecular explanation of the actions of genes (for example, in mutation, evolution and gene expression). Furthermore, the way in which Nirenberg and Khorana cracked the genetic code – by comparing short sequences of RNA with the resulting amino acid sequences – can be re-run as an inquiry-based teaching activity at school. Using the sequences provided by the teacher, the students work in teams to:

• Identify patterns
• Construct hypotheses and explanatory models
• Design experiments
• Reach conclusions from partial data
• Establish the strength of their conclusions
• Communicate and justify their conclusions in a scientific manner.

The activity thus offers a model for teaching the nature of scientific knowledge: a provisory consensus constructed by the community with conclusions of diverse strength based on partial evidence.

Cracking the code in the classroom

This activity is suitable for 14- to 18-year-old students working in teams of 3–4, and takes about two hours, divided into four steps plus a final discussion. It is designed as an introduction to molecular biology, before you explain anything about the genetic code or the central dogma of molecular biology.

Students are asked to crack a code composed of different sequences of letters (A, C, T, G) using the messages that those sequences encode (e.g. AspHisTrp…). In each of the first three steps, each team is given a different set of letter sequences and corresponding messages. At each step, they will need to re-evaluate their conclusions from the previous steps, and modify their solution to the code.

Explain that all the groups will be working to crack the same code, using different examples. Do not tell your students about the biological nature of the sequences (DNA and amino acids); they should focus on finding patterns and relationships.

Nirenberg and Khorana used RNA sequences to crack the code; in contrast, this activity uses DNA sequences (sense codons, 5′ to 3′). The crux of the activity is the existence of the code rather than the details of transcription and translation, which can be addressed in subsequent lessons.

After each step, you may ask one student from each team to join a different team. (This mimics the dynamics of how scientific knowledge is acquired and shared, for example at conferences or through publications.)

Otherwise, teams may exchange information only when they are told to do so. (If one team gets stuck and discouraged, it can be more motivating to ask another team to help them rather than the teacher.)

Materials

• Worksheets 1-4 for each team, which can be downloaded from the column on the right. The sequence sets are different for each team.
• Figure 1 or a smartphone app for easily converting DNA codons to amino acids^w1.

Procedure

Allow at least 10-15 minutes for your students to discuss each step. When all the teams feel that they have obtained all the possible information from their sequences, move on to the next step.

1. Detecting frames. Give each team a copy of worksheet 1, which contains three sequences that do not contain synonym codons or stop codons. All the sequences begin with an ATG codon, encoding the amino acid methionine (Met).
   Using the three sequences, the students should be able to establish that the code is based on triplets of letters and to make their first hypotheses about the meaning of some of these triplets.

   Table 1: An example of worksheet 1

   Sequence	Message	Students discover that…
   ATGTTAGGTAGTAAAGATGCT	MetLeuGlySerLysAspAla	The code is based on triplets and each triplet represents one of the three-letter elements, e.g. Met.
   ATGCATGAAGCTATTTATGAT	MetHisGluAlaIleTyrAsp
   ATGGGTAGTGATGAAGCTTAT	MetGlySerAspGluAlaTyr

2. Building a model. Give each team a copy of worksheet 2, which contains three new sequences, some of which include synonym codons.
   The students should be able to confirm some of their hypotheses from step 1, while other hypotheses may be cast into doubt.

   Table 2: An example of one team’s sequences for step 2

   Sequence	Message	Students discover that…
   ATGGTTTCGTACACTGCGTCA	MetValSerTyrThrAlaSer	Some elements can be encoded by more than one triplet, e.g. Ser.
   ATGCCGTACACATGTGTCACA	MetProTyrThrCysValThr
   ATGACGAGTGCGTTGTGCGAT	MetThrSerAlaLeuCysAsp

3. Adjusting the model to new evidence. Give each team a copy of worksheet 3, which contains new sequences presenting more complexity: some sequences lack the initial ATG codon, some have it further into the sequence, and some have a stop codon. These characteristics either result in messages that are shorter than the seven-amino-acid sequences in the previous steps, or produce no message at all.
   The worksheets for this step each contain two lists of sequences. You can choose whether to give your students all the sequences together (to make this step easier) or in two separate sub-steps (to make it harder).
   Besides confirming the triplets that encode some amino acids, these sequences allow the students to identify the key roles of the methionine (start) and stop codons.

   Table 3: An example of one team’s sequences for step 3

   Sequence	Message	Students discover that…
   TGTCATGCATCCGTCATCACTGAC	–	The ATG triplet determines the beginning of the message and the TGA triplet its end.
   TGCGTGACTATGGACACAGTCGT	MetAspThrVal
   ATGTGTCGATGACTGATCATG	MetCysArg
   ATGTGCGTACACATTTGAGTC	MetCysValHisIle
   ATGCTGTACACATGATGCACAGT	MetLeuTyrThr

4. Testing hypotheses and designing experiments. The students should now be able to propose a partial solution to the code. To test their hypotheses, give each team a copy of worksheet 4 and ask them to design an experiment. They should propose changes to four specific sequences that they were given in the previous steps, and note any change that they would expect to the message. You then give them the correct message, using figure 1 if necessary. Was the result what they expected? If not, what does that tell them? This mimics a rapid process of hypothesising, designing experiments and analysing results.
   As a conclusion to the activity, each team should present their partial solution for the code to the rest of the class, justifying their conclusions. Those parts of the code that are accepted by the rest of the group – representing the scientific community – should be written on the blackboard. Controversial or unclear parts should also be noted. The result will be a consensual, partial genetic code.
   Avoid confirming immediately if the code that your students have constructed is correct. Explain that in science, there is no book to compare your results to, and the only way to find if something is correct is by asking good questions, designing good experiments, and sharing information and ideas with your peers to gain consensus.

Discussion

Ask your students to consider the following questions:

• How did you discover what you now know?
• Did you discuss your ideas with anyone during the activity? What did you discuss?
• How did you confirm whether your hypotheses were accurate?
• Did you reject any of your initial hypotheses? Which ones?
• How did you resolve any contradictory conclusions within or between teams?
• Were all your conclusions equally strong?

After the discussion, explain to your students that the sequences were DNA and amino acid sequences, and that they have just reproduced a real key experiment in molecular biology. Your students should now be motivated to learn more about the genetic code and the central dogma of molecular biology, including how similar their activity was to the way in which the genetic code was really cracked.

You could recap the activity, reminding your students what they discovered for themselves:

• In step 1, that the genetic code is based on triplets of nucleotides (codons).
• In step 2, that the genetic code is redundant but not ambiguous: each codon encodes a single element (e.g. an amino acid), but some elements are encoded by more than one codon.
• In step 3, that the code includes start and stop codons to specify the beginning and the end of the encoded amino acid sequences.

(Note that the activity could generate the misconception that proteins are usually composed of six or seven amino acids, so this may need to be addressed.)

Explain that the way your students have been working, in collaborative and / or competitive teams, with the membership of the teams changing, and information being shared with other teams, reflects the way that scientists work in real life.

Adaptations

To make the activity easier, you could give your students more sequences in each step (e.g. the sequence sets for two teams). Alternatively, you could leave out step 3, and simply explain the role of the start and stop codons after the activity.

Acknowledgements

Pedagogic reflections on the activity described in this article are part of the work of the language and context in science education (llenguatge i contextos en educació científica, LICEC) research group at the Autonomous University of Barcelona (reference 2014SGR1492), financed by the Spanish Ministry of Economics and Competitiveness (reference EDU2015-66643-C2-1-P).